t dna left border sequence
The vird2 protein is covalently attached to the 5 end. A vird1 d2 complex nicks the dna at the left and right border sequences. For pcr 1 lba1 primer.
2 please re set the parameter ext5 or max n value according to the distance from their lb to the insertion site.

T dna left border sequence. 5 tggttcacgtagtgggccatcg 3 for pcr 2 and sequencing we use lbb1 primer. The t dna left border sequence was used for pcr amplification of plant flanking sequences. 5 tggttcacgtagtgggccatcg 3 for pcr 2 and sequencing lbb1 primer. T dna borders a set of 24 kb sequences present on either side right left of t dna are also transferred to the plant cells.
The bacterial t dna is about 24 000 base pairs long and contains plant expressed genes that code for enzymes synthesizing opines and phytohormones. This region has the genes for the biosynthesis of auxin aux cytokinin cyt and opine ocs and is flanked by left and right borders. This is done by removing most of the t dna while leaving the left and right border sequences which integrate a foreign gene into the genome of cultured plant cells. It is the expression of these genes that induces the gall tumors as well as the production of compounds opines that agrobacterium uses as nutrients.
Left and right border sequence 24 bp which will betransferred into genome of host plant. Contains one or more t dna region that is integrated into the plant host genome of size 12to24kb. The second delivery method is a gene gun which fires gold particles carrying the foreign dna into plant cells. Contain a virregion 40kb at least 8 11virgenes.
Contains one or more t dna region that is integrated into the genome of host plants of size 12 to 24 kb. The t dna must be cut out of the circular plasmid. Now you could paste any t dna lines on the t dna express to design their primers lp rp. The t dna is bordered by 25 base pair repeats on each end.
Ipt precursor for cytokinin synthesis. The new ext5 or max n 300 thedistance 110. T dna usually contains eight contiguous genes delineated by the left and right border sequences. 5 gcgtggaccgcttgctgcaact 3 salk seq lines.
It is clearly established that the right border is more critical. Transfer is initiated at the right border and terminated at the left border and requires the vir genes of the ti plasmid. Iaah indole acetamide hydrolase these two constitutes auxin biosynthesis. New insertions have been identified for a number of the segregating salk sail and wiscdslox lines.
Right and left border sequence 24bp which will be transferred into the host plant genome. The t dna left border sequence was used for pcr amplification of plant flanking sequences.













































































