a multiplexed homology directed dna repair assay
A 2 058 bp dna fragment for the mgacas9 cleavage assay was obtained by pcr using as a template hek293 atcc. To explore multiplexed silencing of endogenous human genes with s. Crispr techniques are allowing the development of technologies for nucleic acid detection see the perspective by chertow.
At 30 days post transfection we observed robust multiplexed gene silencing of each gene combination figure 1i.

A multiplexed homology directed dna repair assay. Intravenous injection facilitated tissue specific multiplexed editing of six genes in mouse lungs. Crispr gene editing pronounced ˈ k r i s p ə r crisper is a genetic engineering technique in molecular biology by which the genomes of living organisms may be modified. Maintenance of genome stability is promoted by a network of cellular pathways known as the dna damage response ddr. Crl 1573 genomic dna and a 5 tcctgagacttccacactgatgc 3 and 5.
Ddr proteins often exert numerous distinct functions with some factors regulating both dna repair and dna damage checkpoints e g atm 53bp1 and others controlling multiple dna repair processes e g brca1 ciccia and elledge 2010. The wild type spcas9 is able to mediate site specific dsbs which can be repaired through either nhej or homology directed repair hdr. A t7ei cleavage assay of dna. 4a 12 13 20 because nicked genomic dna is typically.
Homology directed repair a dna repair mechanism that uses a template to repair dna nicks or dsbs. We engineered an aspartate to alanine substitution d10a in the ruvc i domain of spcas9 to convert the nuclease into a dna nickase spcas9n fig. By delivering the cas9 nuclease complexed with a synthetic guide rna grna into a cell the cell s genome can be cut at a. A dna repair mechanism that often introduces indels.
22 for example nuclease off target effects can occur in transformed human cell lines with dysregulated dsbs repair pathways while whole genome sequencing of healthy human pluripotent. Pyogenes based crisproff we targeted itgb1 cd81 and cd151 in two three and four gene combinations figures 1i 1k and s1i s1k. Off target effects might be cell type specific and highly depending on the integrity of double stranded breaks dsbs repair pathways of particular cell type. Developed an improved nucleic acid detection technology for multiplexed quantitative and highly sensitive detection combined with lateral flow for visual readout.
It is based on a simplified version of the bacterial crispr cas9 antiviral defense system. Or homology directed repair for gene modifications.
























































































